PART I: Genetics Project: Debate
Argument
CON: DNA record keeping is an invasion of privacy
CON: DNA record keeping is an invasion of privacy
Why
Many people feel that by the Government keeping a record of their DNA is invading their personal privacy. My debate is meant to show the positive things created from the use of DNA record keeping
Research
- Remains of soldiers could not be found if their DNA wasn't previously stored
- Investigators could not determine suspects of a crime, some of which may be a potential threat to citizens
- Althought some says it allows the government to access private health records, whats the harm?
- The government can use it as a helpful protective tool and it really has no true harm to anyone.
- One should have confidence in their behavior that it shouldn't matter if a record of their DNA is kept.
- Having someone volunteer to have their DNA tested by different research companies can help us determine ways to fight off diseases we may have never been able to before.
PART II: Genetics Project: Design a Species





CREATURE

Head Shape: Square (SS/Ss)
Hair: Crimped (CC/Cc)
Mouth: Closed Smile (Mm)
Eyes: Circle Eyes (K)
Nose: No Nose (X^NY)
CREATURE W/ DIFFERENT GENOTYPE
Head: Round (ss)
Hair: Straight (cc)
Mouth: Open Smiley (MM)
Eyes: Triangle (J)
Nose: Nose (X^nY)
PEDIGREE
DI-HYBRID CROSS
RATIO:
Square head and Crimped hair: 16
Square head and Straight hair: 0
Round head and Crimped hair: 0
Round head and Straight hair: 0
Questions/Practice Problems
1. Cross a Heterozygous species with Square head and Crimped hair with a Homozygous recessive species with Round head and Straight hair. Show the Cross for both the Parent and F1 generation. Show the ratios for the F1 generation.
2. Using the Di-Hybrid cross pictured above, create another cross with the F1 generation.
3. Create your own Pedigree using traits for Head Shape.
PART III: Genetics Project: Creature DNA Fingerprinting
WHO SAID THE EASTER BUNNY ISN'T REAL!?!?!
GCCTATGGGCAGTCTATCCCGGGATCGGGCTATACGGTCAGCCGGTACTC
CGGATACCCGTCAGATAGGGCCCTAGCCCGATATGCCAGTCGGCCATGAG

You have some really good points about how DNA record keeping is not an invasion of privacy. Maybe you can go into more detail about some of your points, but other than that, your blog is looking good.
ReplyDeleteAs of right now, your blog is not as informational as it could be, You have good arguments, but i agree with kelly, you could add more detail to make it better.
ReplyDeleteWell I think your blog is really good. First of all i like the color choice you picked :). I also like you adding that dread onto your creature. Nice. I agree with your argument because you wouldn't be able to find ANYONE if it was an invasion of privacy, so good job. Just don't forget to add your links on for your information.
ReplyDeleteIt is on! Ha Ha no I am just kidding. But i thik that your blog is a great start. I thik that maybe you should add some more on for your debate so that it has astronger and more effcting point. Also the layout is nice because it is nice and simple.
ReplyDeleteYou did great on your blog, but perhaps you need more information about the debate
ReplyDelete